Analysis of the polymorphic structure of short tandem repeats locus D18S555

2.1. DNA samples 

DNA was extracted by the standard phenol/chloroform method from blood samples from 200 unrelated Japanese individuals and bloodstains provided by 169 Chinese individuals (unidentifiable, anonymous). The use of these Japanese samples in this study was approved by the Teikyo University School of Medicine Ethics Committee in Genetic Research.

2.2. PCR amplification of the D18S555 region and DNA sequencing 

To amplify the D18S555 region, the following primers were prepared as reported by Armour et al. [5]: at the 5′ end, D18S555-F (ggga), GTGCGATGGCAAAATAGATG; and at the 3′ end, D18S555-R, ATTTTCTAG GAAAGAGCTAGC. The reaction mixture (25μl) contained 0.25μM of each primer, 0.2mM of each dNTP, 1.5mM MgCl2, 1×buffer (67mM Tris/HCl, 16.6mM (NH4)2SO4 4.5% TritonX-100, 0.2mg/ml gelatin, pH 8.8), 0.75U Taq DNA polymerase, and 25ng of template DNA. PCR using either pair of primers was performed for 30 cycles of 1min at 94°C, 1min at 50°C, and 2min at 72°C. A 2μl aliquot of the PCR product was mixed with an equal volume of STR 2× Loading Solution (Promega), the mixture was electrophoresed (Fig. 1), and the bands were silver-stained. The stained DNA band for each allele was excised and immersed in 50μl of TE buffer to elute the DNA from the gel. The elute was sequenced using a fmol DNA Sequencing System (Promega). The resulting product was electrophoresed and visualized by autoradiography [1], [6].

View Large Image Download to PowerPoint

Fig. 1. Examples of genotyping at D18S555 in 12 individuals in 6% denaturing (7M urea) polyacrylamide gel electrophoresis (16cm×16cm×0.1cm, 200V, 3h, 0.5×TBE buffer) followed by silver staining. (1) 1/13; (2) 3/5; (3) 6/13; (4) 3/6; (5) 4/13; (6) 4/7; (7) 12/13; (8) 10/13; (9) 10/15; (10) 13/14; (11) 12/13; (12) 3/6; (M); allelic ladder marker.

3.1. Basic structure of D18S555 locus 

The D18S555 locus was amplified by PCR. Electrophoresis of the amplified DNA on polyacrylamide gels (Fig. 1), followed by silver staining, confirmed the presence of 11 different bands. Dozens of different DNA bands that had migrated to the same position were excised from the gels, and DNA-sequenced.

As a result, the longest allele 15 was regarded as representing the basic structure, while the other ten alleles consisted of various, deletions: (a) gaaagaaagaat, (b) ggaa, (c) ggaaggaaggag, (d) ggaaggagggaaggaaggag, (e) gggaggaa, (f) (ggga) 5, and (g) ggaa. A variation in the number of repeats was found in ggga at 3′ end. Thus, we confirmed that these alleles do not contain different repeats of two kinds of RRGG, but that deletions or insertions of the sequence motifs (a), (b), (c), (d), (e), (f), and (g) give rise to polymorphism at this locus (Fig. 2).

View Large Image Download to PowerPoint

Fig. 2. The sequence of the longest allele 15, and the each positions (a)–(g) of deletions or insertions.

3.2. Nomenclature for D18S555 alleles and the structure of variants 

The 11 different alleles confirmed in this study were designated alleles 1 (238bp) through 15 (294bp) in the order of the DNA chain length. When allele 15 with the longest DNA chain was regarded as representing the basic DNA sequence, allele 1 had (ggga) 6 and deletions of the sequence motifs (a), (c), (e), (f),and (g); allele 3, (ggga) 7 and deletions of the sequence motifs (d), (e), (f), and (g); allele 4, (ggga) 6 and deletions of the sequence motifs (a), (e), (f), and (g); allele 5, (ggga) 7 and deletions of the sequence motifs (a), (e), (f), and (g); allele 6, (ggga) 8 and deletions of the sequence motifs (a), (e), (f), and (g); allele 7, (ggga) 9 and deletions of the sequence motifs (a), (e), (f), and (g); allele 10, (ggga) 6 and deletions of the sequence motifs (c) and (e); allele 12, (ggga) 6 and deletions of the sequence motifs (b) (e); allele 13, (ggga) 6 and deletion of the sequence motif (e) and allele 14, (ggga) 7 and deletion of the sequence motif (e). Thus we confirmed that differences in sequence motif deletions and in the number of ggga repeats gave rise to D18S555 polymorphism. No other, alleles were observed in this study (Table 1).

Table 1. Polymorphic structure, ggga repeats, and the fragment length of the each D18S555 allelesa

	Allele	Polymorphic structure	Size (bp)
	1	[15 - (a) (c) (e) (f) (g)]+(ggga) 6	238
	2	⋯
	3	[15 - (d) (e) (f) (g)]+(ggga) 7	246
	4	[15 - (a) (e) (f) (g)]+(ggga) 7	250
	5	[15 - (a) (c) (e) (f) (g)]+(ggga) 6	254
	6	[15 - (a) (e) (f) (g)]+(ggga) 8	258
	7	[15 - (a) (e) (f) (g)]+(ggga) 9	262
	8	⋯
	9	⋯
	10	[15 - (c) (e)]+(ggga) 6	274
	11	⋯
	12	[15 - (b) (e)]+(ggga) 6	282
	13	[15 - (e)]+(ggga) 6	286
	14	[15 - (e)]+(ggga) 7	290
	15	Fig. 2	294

a -(e) means the deletion of (e). ⋯ means not identified.

3.3. Polymorphism at the D18S555 

Using DNA samples obtained from 200 Japanese and 169 Chinese subjects, we examined the distribution of D18S555 allele frequencies (Table 2). Neither showed any statistically significant shift (χ2-test), in which alleles 4, 6, and 13 showed high frequencies. However, alleles tended to be dispersed in Chinese samples, in which allele 1 was observed. The observed heterozygosity rate was high in the Chinese (75%), compared with that in the Japanese (68%) samples. The genotype distribution did not deviate from the Hardy–Weinberg equilibrium [7] in the two population groups (Japanese: χ2=1.2635, P>0.9, df=5; Chinese: χ2=3.7923, 0.5>P>0.3, df=5 [8]) (Table 2, A and B). Some parameters of forensic identification and paternity interest were determined using Powerstats software (Promega) [9] (Table 3). Although Armour et al. [5] reported that the D18S555 locus showed a tetranucleotide (RRGG) repeat polymorphism, our analysis of the locus structure and allele distribution in Japanese and Chinese samples revealed that the polymorphism resulted from differences in deletions or insertions of at least six sequence motifs (a) through (f), and in the number of ggga repeats, thus giving rise to allele-specific sequences. D18S555 genotyping requires no DNA sequence analysis, and making this locus applicable to forensic identity testing.

Table 2. Genotype distributions of D18S555 alleles in 200 Japanese individuals (A) and 169 Chinese individuals (B)a

	Allele	1	3	4	5	6	7	10	12	13	14	15
	(A) Japanese populationb
	1
	3			2		2
	4			19	1	30			1	51		2
	5
	6					7	1			41
	7
	10									1
	12
	13									39	1	2
	14, 15
	(B) Chinese populationc
	1					1				1
	3			2	1	7		1		4
	4			13		15	1		1	58		4
	5
	6					4			1	19		2
	7
	10									1		1
	12										3
	13									25	1	3
	14, 15

a Two alleles in one individual are shown in horizontal and vertical axes. The alleles are grouped in three (1–5, 6–7, 10–15) and analyzed for χ2 test. b Japanese; χ2=1.2635, P>0.9; df=5 (three alleles model; 1–5, 6–7, 10–15). c Chinese; χ2=3.7923, 0.5>P>0.3; df=5 (three alleles model; 1–5, 6–7, 10–15).

Table 3. D18S555 allele frequencies in Japanese and Chinese, and forensic parameters and paternity interest

	Allele	Japanese		Chinese
		Obs. no.	(%)	Obs. no.	(%)
	1	–		2	(0.59)
	2	–		–
	3	4	(1.0)	15	(4.44)
	4	126	(31.5)	107	(31.66)
	5	1	(0.25)	1	(0.3)
	6	87	(21.75)	53	(15.68)
	7	1	(0.25)	1	(0.3)
	8	–		–
	9	–		–	(0.88)
	10	1	(0.25)	3
	11	–		–	(1.47)
	12	1	(0.25)	5	(1.42)
	13	174	(43.5)	140	(41.42)
	14	1	(0.25)	1	(0.3)
	15	4	(1.0)	10	(2.96)
	Total alleles	400		338
	Obs. hetrozygosity (%)		67.5		75.1
	Forensic identifications
	Matching probability		0.178		0.171
	Expressed as 1 in …		5.6		5.9
	Power of discrimination		0.822		0.829
	Polymorphism information content		0.60		0.65
	Paternity
	Power of Exclusion		0.391		0.512
	Typical paternity index		1.54		2.01